|
HowTo
A collection of Howtos
Featured
Biopieces setup and testHowto update BiopiecesBiopieces are continuously updated, and it is highly recommended to keep your own version up to date, since there is no such thing as stable releases. Updating Biopieces is a two step process where the code and the wiki is updated separately using subversion. There is an alias for this so simply run the following command: bp_update Howto test BiopiecesBiopieces comes with a testing suite for testing all (well, only a few for now) Biopieces with all the different options (in a perfect world). Run the following command to test your installation: bp_test Howto setup default MySQL username and passwordBiopieces can read configuration information from the ~/.biopiecesrc file. The information in the file is written as a single Biopiece record, that with respect to default MySQL settings look like this: MYSQL_USER: Martin MYSQL_PASSWORD: Swordfish --- So, in order to allow the different Biopieces to access the MySQL database to read default username and password settings - so you don't have to type these out everytime you run one of these Biopieces - edit the ~/.biopiecesrc on your system with your favorite editor, and enter an entry like the above and modify the MYSQL_USER and MYSQL_PASSWORD. Finally save the file and change the permissioins on the file so other users cannot see your password: chmod 600 ~/.biopiecesrc Record manipulationsHowto select records from the stream matching a list of identifiersOften you need to select records from the stream that matches a list of e.g. sequence names. In order to do this we need grab and a file with a list of identifiers - one per line - that matches exactly a key in the stream. So to extract particular sequences from e.g. the below FASTA file in the file test.fna ... >HA8CWBL01B9XZN ACGAGTGCGTCCTACGGGAGGCAGCAGTGGGGAATCTTCC >HA8CWBL01AI903 ATAGAGTACTCCTACGGGGCGCAGCAGTGGGGAATCTTCC >HA8CWBL01CUX4D ACGAGTGCGTCCTACGGGGTGCAGCAGTGGGGAATCTTCC >HA8CWBL01CUSUJ TGTGAGTAGTCCTATGGGATGCAGCAGTGGGGAATCTTCC >HA8CWBL01AT53B CGTCTAGTACCCTACGGGAGGCAGCAGTGGGGAATCTTCC >HA8CWBL01CERKQ ACGAGTGCGTCCTACGGGGGGCAGCAGTGGGGAATCTTCC >HA8CWBL01C382Z TGTGAGTGGTCCTACGGGACGCAGCAGTGGGGAATCTTCC >HA8CWBL01AR4X0 TAGTGTAGATCCTACGGGATGCAGCAGTGGGGAATCTTCC >HA8CWBL01A35I4 ACGAGTGCGTCCTATGGGGTGCAGCAGTGGGGAATCTTCC >HA8CWBL01C29XM ACGCGAGTATCCTATGGGAGGCAGCAGTGGGGAATCTTCC ... wanting the records where the SEQ_NAME matches the identifiers in the file test.id: HA8CWBL01CUX4D HA8CWBL01AR4X0 HA8CWBL01CUSUJ HA8CWBL01C29XM HA8CWBL01A35I4 We simply do: read_fasta -i test.fna | grab -E test.id -k SEQ_NAME ... Sequence manipulationsHowto turn FASTQ files into FASTA filesThis is easily done using read_fastq and write_fasta. Basically, any entries that contain a SEQ_NAME and SEQ keys can be written to FASTA files using write_fasta, and since read_fastq yields these keys, the conversion is pretty trivial: read_fastq -i data.fq | write_fasta -o data.fq -x Howto turn FASTA files into FASTQ filesIn order to do this you need to add quality SCORES. This might not be a good idea since you are probably going to feed this bogus quality score data to downstream software that is tuned for real-life data. However, you can simply add quality SCORES using compute to yield a specified score (here h=Q40) to data read with read_fasta, and simply write the FASTQ data with write_fastq: read_fasta -i data.fna | compute -e 'SCORES="h" x SEQ_LEN' | write_fastq -o data.fq -x Sequence searchHowto map short sequencesMapping short sequences to a reference is a two-step process which involves first the indexing of the reference, and second the mapping itself. Biopieces contains wrappers for a number of different short sequence mappers: And their respective indexing tools:
All of the above pretty much have the same options so it is simply: read_fasta -i reference.fna | create_<bowtie|bwa|vmatch>_index -d <directory> -i <index name> -x The index files will be prefixed with <index name> and then put into the specified <directory>, which is craeated for the occation. To map sequences against the index we simply do: read_fasta -i data.fna | <bowtie|bwa|vmatch>_seq -i <index name> | write_bed -o result.bed -x And the result will be written in BED format. Other formats can be used as well. Howto search with long sequencesBLAT and BLAST are very useful tools for searching long sequences. Biopiece wrappers are available for both: blat_seq don't require an index, so we can simply do: read_fasta -i data.fna | blat_seq -d reference.fna | write_psl -o result.psl -x And the result will be written in PSL format. Other formats can be used as well. BLAST requires an indexed reference sequence and are index in a similar was to the indexes described in Howto map short sequences using create_blast_index. So for BLAST we do: read_fasta -i reference.fna | create_blast_index -d <directory> -i <index name> -x read_fasta -i data.fna | blast_seq -d <index name> | write_bed -o result.bed -x Howto search for patternsSearching for patterns is best done with patscan_seq which is a wrapper around scan_for_matches, the best pattern scanning software ever. Patterns can be designed carefully allowing ambiguity codes, mismatches, insertions, and deletions as well as stem loops (nucleotides only). So basically we can do: read_fasta -i data.fna | patscan_seq -p <pattern> | write_bed -o result.bed -x And the result is written to a BED file. Now, the pattern can be simple such as a seqeunce: ATCG Or a more complex pattern like a stem capped by a tetra-loop p1=ATCG 4...4 ~p1[1,0,0] where the one strand of the stem is ATCG and is assigned to pattern 1 (p1), then followed by a range of four unspecified residues and finally the reverse complement of p1 allowing for 1 mismatch, 0 insertions and 0 deletions. Quality assurance and cleaning NGS dataHowto get some basic sequence statisticsSo you have a brand new sequence data set and want to get an overview ... The first thing is to figure out what type of file format the data is store in. FASTA data are typically stored in files with .fna, .fa, .faa, or .fasta suffixes and these can be read using read_fasta. FASTQ files typically have .fq or .fastq suffixes and can be read using read_fastq. Data from Roches's 454 platform can come as SFF with .sff suffix and can be read with read_sff, but can also come in two files, one a FASTA file with the sequence and a FASTA like file with the quality scores. These can be read with read_454. And now to the basic questions: To find out how many sequences you have use count_records: read_fasta -i data.fna | count_records -x Which will output a record with the sequence count: RECORDS_COUNT: 12345678 --- A bit more advanced (and a wee bit slower) you can use analyze_vals which in addtion to record count will tell you the minimum, maximum and mean sequence lengths among other things: read_fasta -i data.fna | analyze_vals -x Then you get a table like this: KEY SEQ SEQ_LEN SEQ_NAME TYPE alph num alph COUNT 100000 100000 100000 MIN 0 0 43 MAX 50 50 45 SUM 4952206.00 4952206.00 4405662.00 MEAN 49.52 49.52 44.06 Which is basically the output of these Biopieces: If you want to analyze the sequence composition you can use analyze_seq which will yield the residue composition, and the percentages of how many residues are soft masked (i.e. lower case) and hard masked (i.e. N's), and the GC%. SEQ_NAME: ILLUMINA-52179E_0004:2:1:1040:5263#TTAGGC/1 SEQ: TTCGGCATCGGCGGCGACGTTGGCGGCGGGGCCGGGCGGGTCGANNNCAT SEQ_LEN: 50 RES[T]: 7 RES[C]: 13 RES[G]: 23 RES[A]: 4 RES[N]: 3 SOFT_MASK%: 0.0 HARD_MASK%: 6.0 GC%: 72.0 --- Thus to get the mean HARD_MASK% for all records in the stream, you need to use analyze_seq followed by mean_vals like this: read_fasta -i data.fna | analyze_seq | mean_vals -k HARD_MASK% -x Which outputs the mean in a record like this: HARD_MASK%_MEAN: 3.80 REC_TYPE: MEAN --- See also Howto determine the GC content of a data set. Howto determine the GC content of a data setTo get the mean GC content of a sequence you can use analyze_gc, and if you want the mean GC content for a stack of sequences you simply calculate the mean using mean_vals: read_fasta -i data.fna | analyze_gc | mean_vals -k GC% -x Which will output a record with the mean GC content: GC%_MEAN: 37.50 --- Howto collect several sequence filesWith the comming of the Illumina HiSeq platform the sequence data from each experiment may come as multiple files. These can be collected like this: read_fastq -i ‘experiment_X_*.fastq.gz’ | write_fastq -Zo experiment_X_all.fq.gz -x Notice that we keep the data zipped to avoid filling up the disks unnecessarily. Howto remove filtered sequences from Illumina HiSeq dataSome sequences have suboptimal quality scores and have been flagged as filtered by the CASAVA 1.8 pipeline. These contain a Y in the sequence name as in "filtered? Yes!". We need to remove these like this: read_fastq -i data.fq.gz | grab -ip ‘:Y:’ -k SEQ_NAME | write_fastq -Zo data_filt.fq.gz -x It is probably a good idea to check how many sequences were filtered. Use count_records for that. Howto split a NGS data set according to barcodesBarcodes are DNA tags of 6-11 bases that are added to experiements allowing for simultaniously sequencing of multiple experiments, which can then be seperated after sequencing based on the barcodes. Splitting a NGS data set on DNA barcodes can be done by reading the data followed by find_barcodes to locate (and remove) the barcodes, and finally, write the sequences to files according to the barcode name with write_fasta_files like this: read_sff -i data.sff | # Read the data from a SFF file find_barcodes -p 4 -m 2 | # Look for barcode at position 4 and allow for 2 mismatches write_fasta_files -d Output_dir -k BARCODE_NAME -x # Write FASTA files And the resulting files will end up in the Output_dir: Output_dir/ |-- MID1.fasta |-- MID10.fasta |-- MID104.fasta |-- MID106.fasta |-- MID107.fasta |-- MID109.fasta ... In the above example we are looking for Roche's MID barcodes, which are hard coded in find_barcodes. It is possible to use a list of custom barcodes (see find_barcodes). It is possible to start with FASTA and QUAL files using read_454 instead of read_sff, and it is possible to preserve the quality scores by saving the output in FASTQ format using write_fastq_files instead of write_fasta_files. Howto plot quality scoresPlot the mean quality score using plot_scores like this: read_fastq -i data.fq.gz | plot_scores -t png -o data_scores.png -x This will output a PNG file with the mean scores:
Howto trim sequence endsSince the quality scores of the sequences deteriorate with sequence length, we need to trim sequences from the ends that have suboptimal quality scores. We do this pretty conservatively by using the threshold Q20 with trim_seq. Also, since some sequences will be trimmed down to length 0, we need to filter these (using grab) an only keep sequences of a minimum length: read_fastq -i data.fq.gz | trim_seq -m 20 | grab -e ‘SEQ_LEN>=50’| write_fastq -Zo data_etrim.fq.gz -x Howto identify quality scores with local minimaSome sequences may contain a region with suboptimal sequence after end trimming (see Howto trim sequence ends). These can be identified by running a sliding window over the sequence to locate local minima, and if any such is found, the sequence can be discarded. We use mean_scores for that followed by grab: read_fastq -i Ex1_filt_etrim.fq.gz | mean_scores -l | grab -e ‘SCORES_LOCAL_MEAN>=15’ | write_fastq -Zo Ex1_filt_etrim_ltrim.fq.gz -x Do count how many sequences were filtered using count_records. Also you can plot the mean scores. See Howto plot quality scores. De novo assemblyAssembly is the art of stitching together short sequences into longer contig -uous regions. Genome assembly without a reference to use as backbone is called de novo assembly. De novo assembly using 454 reads should be done with Newbler and MIRA for the best results. Howto do genome assemblyIllumina reads can be assembled using the following Biopieces which are basic wrappers: There is no single best way of performing genome assembly, so it is recommended to do a number of assemblies with different filtering and assemblers and compare the results. The assembler Biopieces do multiple assemblies with a range of different parameters, like k-mer sizes. Also, the starting data may or may not benefit from rigorously trimming and cleaning. So for all of the assemblers you can do this: read_fastq -i data.fq.gz | assemble_seq_<assembler> -d <directory> -k <min k-mer size> -K <max k-mer size> | write_fasta -o contigs.fna -x The assemble_seq_velvet and assemble_seq_ray will produce a number of assemblies that will be stored in the <directory> and only the best assembly - determined from the highest N50 - will be output to the stream and stored in the FASTA file. assemble_seq_idba is iterative and only outputs the best assembly. The result of the assemblies can be evaluated using analyze_assembly (see Howto analyze assembled contigs). Howto do meta-genome assemblyAssembly is done using Meta-IDBA. read_fastq -i Ex1_filt_etrim_ltrim.fq.gz | assemble_seq_idba -m -k 50 -K 80 -d IDBA | write_fasta -Zo Ex1_assembly.fna.gz metavelvet - needs to be studies (probably in Japanese). Howto analyze assembled contigsAssembled contigs can be analyzed to get some stats using analyze_assembly. We include a filtering step to discard contigs shorter than 200 bases: read_fasta -i contigs.fna | grab -e "SEQ_LEN>=200" | analyze_assembly -x And the output: N50: 9082 MAX: 52038 MIN: 200 MEAN: 4170 TOTAL: 3057214 COUNT: 733 --- Notice that with the -g switch analyze_seq will calculate a predicted gene coverage that is a useful metric for comparing multiple assemblies. Finding SNPs and DIPsHowto find SNPs and DIPsMany different tools exists for calling single nucleotide polymorphims (SNP) and deletion/insertion polymophisms (DIP). Basically, these work by mapping sequences to a reference and do advanced statistics on the descrepancies. Sometimes, this is follwed by realignment sequences around the positions of interest - and more statistics. Biopieces have a naive step-wise method which focusses on rigorous trimming and cleaning of sequnces to minimize the impact of SNPs and DIPs caused by residues with substandard quality. So the steps are:
SNPs and DIPs can be found in KISS or SAM type records using find_SNPs: read_sam -i mapping_result.sam | find_SNPs | grab -e "REC_TYPE eq SNP" | sort_records -rk SNP_COUNTn | write_tab -cx Which will yield a table outlined below, from where it is easy to distinguish real SNPs from the SNP_COUNT alone: #SNP_COUNT EVENT S_ID REC_TYPE TYPE POS 65 T>G gi|48994873|gb|U00096.2| SNP MISMATCH 2500 62 G>- gi|48994873|gb|U00096.2| SNP DELETION 7000 57 T>A gi|48994873|gb|U00096.2| SNP MISMATCH 2000 55 C>A gi|48994873|gb|U00096.2| SNP MISMATCH 1500 51 G>C gi|48994873|gb|U00096.2| SNP MISMATCH 1000 49 G>- gi|48994873|gb|U00096.2| SNP DELETION 7500 48 T>G gi|48994873|gb|U00096.2| SNP MISMATCH 500 43 ->A gi|48994873|gb|U00096.2| SNP INSERTION 3500 36 ->A gi|48994873|gb|U00096.2| SNP INSERTION 2999 4 T>A gi|48994873|gb|U00096.2| SNP MISMATCH 3499 Annotating sequencesHowto find ORFsAdvanced Biopiece useHow to write the data stream to fileAll Biopieces write the data stream to 'stdout' by default which can be written to a file by using the ubiquitous -O switch: <biopiece> -O <file> It is also possible to use redirection <biopiece> > <file>, but beware that if the biopiece outputs data e.g. FASTA entries then the FASTA data and Biopiece data will be mixed and causing havock. How to read the data stream from fileIf you want to read a data stream that you previously have saved to file in Biopieces format (see How to write the data stream to file) do: <biopiece> -I <file> This switch works with all Biopieces. It is also possible to read in data from multiple sources by repeating: <biopiece> -I <file1> | <biopiece> -I <file2> It is also possible to use a glob expression: <biopiece> -I "*.stream" Note that the glob expression must be in "". It is also possible to use redirection with cat <file> | <biopiece> or <biopiece> < <file>. How to read data from multiple sourcesIt is also possible to read in a saved Biopieces stream (see How to read the data stream from file) as well as reading data in one go: <biopiece> --stream_in=<file1> --data_in=<file2> If you want to read data from several files you can do this: <biopiece> --data_in=<file1> | <biopiece> --data_in=<file2> If you have several data files you can read in all explicitly with a comma separated list: <biopiece> --data_in=file1,file2,file3 And it is also possible to use file globbing: <biopiece> --data_in="*.fna" Or in a combination: <biopiece> --data_in="file1,/dir/*.fna" Finally, it is possible to read in data in different formats using the appropriate Biopiece for each format: <biopiece1> --data_in=<file1> | <biopiece2> --data_in=<file2> ... Howto loop BiopiecesIt is possible to utilize the bash shell to loop over multiple input files. If for an example you have multiple experiments each in one FASTA file, and you for all the files want to obtain the sequences longer than 100 in a new file, you can do: for i in *.fna; do read_fasta -i $i | grab -e 'SEQ_LEN>=100' | write_fasta -o `basename $i .fna`._gt100.fna -x; done Notice that we use the shell tool basename to rename the output files from my_experiment.fna to my_experiment_gt100.fna. Howto alias BiopiecesYou can make aliases to popular commands to save time typing: alias revcomp_seq="reverse_seq | complement_seq" Which makes it possible to reverse-complement sequences like this: read_fasta -i data.fna | revcomp_seq | write_fasta -o data_rc.fna -x You can also use aliases as shortcuts to Biopieces with specific arguments which saves typing: alias blast_refseq="blast_seq -d /var/databases/blast/refseq" To save aliases from session to session save these in your .bashrc file. Howto script BiopiecesOften you get a pipeline that is quite long and to avoid re-typing the commands and avoid the hazzle of copy/pasting across several lines the easy way is to put the pipeline in a shell script. To do this, open a text file with your favorite text editor and enter something like this: #!/bin/sh read_fasta -i HPV.fna | # read in the Human Papilloma Virus genome split_seq -nw 50 | # split the sequence into non-overlapping 50-mers add_ident -k SEQ_NAME | # add a new identifier to all sequences indel_seq -i 1 -d 1 | # add 1 insertions and 1 indel to each sequence mutate_seq -n 1 # mutate 1 residue in the sequence The first line #!/bin/sh is the hashbang or shebang line that tells the operating system that this file should be interpreted with the sh or shell command. Note that you can have comments in the Biopiece script using #. After saving the file (here we saved it as test.sh) you can change the permissions on the file to make it executable so it may be run from the commandline: chmod "+x" test.sh ./test.sh Note that this example here output the resulting Biopiece stream to STDOUT and that you can further manipulate the stream with more Biopieces like this: ./test.sh | count_records -x Howto to use complex Biopiece recordsBiopiece records are based on hash type structures with key/value pairs on separate lines (terminated with a newline or \n) using : (colon followed by a white space) to assign the right side value to the left side key: key: value. Records are delimited by lines of ---. This simple type of records has a number of significant advantages over more complex hierarchical structures such as YAML or XML:
However, since there are very little restaints in the Biopiece format, it is possible to use complex records by serializing the data into strings. One example of complex data that is used in a number of Biopieces are a list of elements, such as the quality SCORES in read_fastq: SCORES: 40;40;40;40;40;40;40;40;40;40;40;40 This is simply a list of scores seperated by a delimiter that in this case is ; and which easily can be used to split the different values. There is no restraints as to how a simple list like this is defined. It could be in brackets and separated by commas to follow the Perl data structure syntax, or it could be something completely different - it is up to the Biopieces that manipulates the relevant data. If you as an example want to use a list of lists you can assign it to a Biopiece records as demonstrated with this table: A1 B1 C1 A2 B2 C2 A3 B3 C3 Which can be written as a Biopiece record like this: cat test.stream TABLE: [ [ 'A1', 'B1', 'C1' ], [ 'A2', 'B2', 'C2' ], [ 'A3', 'B3', 'C3' ] ] --- Now, this way of serializing the table is based on Perl data structures where [] denotes a list of comma separated elements, and embedded [[],[],[]] denotes a list of lists. The advantages here is that we can use Perl's eval command to allow the Perl parser to quickly translate the string to a Perl data structure. We do this with bioscript: bioscript -I test.stream -e '$r = get_record( $in ); $r->{ TABLE2 } = eval $r->{ TABLE }; print Dumper( $r )'
$VAR1 = {
'TABLE' => '[ [ \'A1\', \'B1\', \'C1\' ], [ \'A2\', \'B2\', \'C2\' ], [ \'A3\', \'B3\', \'C3\' ] ]',
'TABLE2' => [
[
'A1',
'B1',
'C1'
],
[
'A2',
'B2',
'C2'
],
[
'A3',
'B3',
'C3'
]
]
};As you can see, TABLE2 contains the eval'ed data which now can be manipulated the Perl way. Of cause we cauld have done the eval in place and thus avoid creating a TABLE2 key: bioscript -I test.stream -e '$r = get_record( $in ); $r->{ TABLE } = eval $r->{ TABLE }; print Dumper( $r )'
$VAR1 = {
'TABLE' => [
[
'A1',
'B1',
'C1'
],
[
'A2',
'B2',
'C2'
],
[
'A3',
'B3',
'C3'
]
]
};Similarly, different XML or YAML parsers can be can be used instead of eval, however, it is up to you to create the Biopieces that emits, parses, and manipulates complex Biopiece records. Only use complex records if you really must. Often it is better to rethink the approach so it can be handled with the ordinary Biopiece records format. Howto use Biopieces with GNU ParallelFor some tasks it is possible to use GNU Parallel which allow execution of Biopieces in parallel using multiple CPUs on multiple servers. In brief, GNU Parallel works by reading from a pipe the content of e.g. a FASTQ file which is then divided into chunks for which a Biopieces pipeline is executed on a separate CPU with the output written to stdout so that it may be redirected to an output file. The below example, where we use the power of GNU Parallel to grab in a FASTQ file, we use cat to feed the raw FASTQ data to parallel which is given the switches --pipe, --recstart, and --recend. --recstart is here set to @EAS which all records start with (the FASTQ format is a bitch so @ alone will not do!) and --recend is set to \n. This allows parallel to correctly divide the raw FASTQ stream into even sized chunks. Following all the arguments is the Biopieces pipeline that we want to run (notice the use of -i - which allows read_fastq to read raw FASTQ data from stdin) - and the result is collected in out.fq: cat in.fq | parallel --block 100M -k --pipe --recstart @EAS --recend '\n' 'read_fastq -i - | grab -k SEQ_NAME -p ':Y:' | write_fastq -x' > out.fq Creating new BiopiecesHowto write usage informationThe usage information for the Biopieces is the help text you get when running a Biopiece with no arguments, or if you are browsing the Biopieces online on the wiki http://code.google.com/p/biopieces/w/list. The usage information is written in Google wiki format http://code.google.com/p/support/wiki/WikiSyntax which means that the usage information is rendered nicely in HTML on the wiki (e.g. [http://code.google.com/p/biopieces/wiki/align_seq align_seq]) and a specific Biopieces print_wiki renders a nice ASCII-text version. This means that you as a developer only need to call the print_wiki Biopiece to render the usage information independent of programming language: print_wiki [options] -i <usage file.wiki> See print_wiki for more details. The usage information exists in one wiki file per Biopiece. For an example the wiki file for the align_seq is located here: ~/biopieces/bp_usage/align_seq.wiki or using the $BP_DIR environment variable: $BP_DIR/bp_usage/align_seq.wiki The basename of the wiki page must be the same as the Biopieces i.e. align_seq for the above example. When creating a new Biopieces start by copying an existing wiki file and edit the content. Do not change the structure of the wiki file - all the sections are mandatory. Do try to re-use the option names - both the full option name and and the single character name. The argument options are devided into different catagories that are used for argument checking:
Remember that there are four ubiquis option names - both long and short - that are reserved: [-? | --help] # Print full usage description. [-I <file> | --stream_in=<file!>] # Read input stream from file - Default=STDIN [-O <file> | --stream_out=<file>] # Write output stream to file - Default=STDOUT [-v | --verbose] Note that flag type options are left blank in the wiki files. Howto create a Biopiece using PerlFirst copy and modify an existing wiki page, see Howto write usage information. Copying existing codeUse the code from a related Biopiece as template if possible, or use one of the simple ones such as split_vals as template. cp $BP_BIN/split_vals $BP_BIN/<new Biopiece> A stripped down BiopieceAfter stripping down the part of the code omitting the parts that were specific to the function of split_seq we end up with this very basic Biopiece (without the line numbering): 1 #!/usr/bin/env perl
2
3 # Copyright (C) 2007-2009 Martin A. Hansen.
4
5 # This program is free software; you can redistribute it and/or
6 # modify it under the terms of the GNU General Public License
7 # as published by the Free Software Foundation; either version 2
8 # of the License, or (at your option) any later version.
9
10 # This program is distributed in the hope that it will be useful,
11 # but WITHOUT ANY WARRANTY; without even the implied warranty of
12 # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
13 # GNU General Public License for more details.
14
15 # You should have received a copy of the GNU General Public License
16 # along with this program; if not, write to the Free Software
17 # Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301, USA.
18
19 # http://www.gnu.org/copyleft/gpl.html
20
21
22 # >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>> DESCRIPTION <<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<
23
24 # Split the values of a key into new key/value pairs.
25
26 # >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<
27
28 use warnings;
29 use strict;
30 use Maasha::Biopieces;
31
32
33 # >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<
34
35
36 my ( $options, $in, $out, $record, @vals, $i );
37
38 $options = Maasha::Biopieces::parse_options(
39 [
40 { long => 'key', short => 'k', type => 'string', mandatory => 'yes', default => undef, allowed => undef, disallowed => undef },
41 { long => 'keys', short => 'K', type => 'list', mandatory => 'no', default => undef, allowed => undef, disallowed => undef },
42 { long => 'delimit', short => 'd', type => 'string', mandatory => 'no', default => '_', allowed => undef, disallowed => undef },
43 ]
44 );
45
46 $in = Maasha::Biopieces::read_stream( $options->{ "stream_in" } );
47 $out = Maasha::Biopieces::write_stream( $options->{ "stream_out" } );
48
49 while ( $record = Maasha::Biopieces::get_record( $in ) )
50 {
51 Maasha::Biopieces::put_record( $record, $out );
52 }
53
54 Maasha::Biopieces::close_stream( $in );
55 Maasha::Biopieces::close_stream( $out );
56
57
58 # >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<
59
60
61 BEGIN
62 {
63 Maasha::Biopieces::status_set();
64 }
65
66
67 END
68 {
69 Maasha::Biopieces::status_log();
70 }
71
72
73 # >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<
74
75
76 __END__The different sections of the Biopiece explainedLet us go over the different sections in this minimalistic Biopiece: Hashbang lineLine 1. First we have the hashbang line #!/usr/bin/env perl, note that we use env perl and not a fixed path! GPL LicenseLines 3-19. Next we have the license text. DescriptionLines 22-26. This section contains a short description that typically is a copy of the Summary section from the wiki file. Include sectionLines 28-30. Here we have a section with use statements. We always have the use warnings and use strict pragmas enabled in Perl, and the use Maasha::Biopieces; enables subroutines from this module, that also always is included. You can include other modules as well. A lot of useful existing modules can be located in $BP_PERL or ~/biopieces/code_perl/. The best way to locate useful modules is to look at the modules included by related Biopieces. OptionsLines 38-44. In this section the Maasha::Biopieces::parse_options subroutine call is of particular interest since this contains the information on the options and their arguments. The argument to the subroutine is a list of hash references. In this particular example the Biopiece have three options apart from the mandatory 4 options that are included in all Biopieces: The three options specific to the split_vals Biopiece: $options = Maasha::Biopieces::parse_options(
[
{ long => 'key', short => 'k', type => 'string', mandatory => 'yes', default => undef, allowed => undef, disallowed => undef },
{ long => 'keys', short => 'K', type => 'list', mandatory => 'no', default => undef, allowed => undef, disallowed => undef },
{ long => 'delimit', short => 'd', type => 'string', mandatory => 'no', default => '_', allowed => undef, disallowed => undef },
]
);The four mandatory options added to the $options hash reference when calling Maasha::Biopieces::parse_options: { long => 'help', short => '?', type => 'flag', mandatory => 'no', default => undef, allowed => undef, disallowed => undef },
{ long => 'stream_in', short => 'I', type => 'file!', mandatory => 'no', default => undef, allowed => undef, disallowed => undef },
{ long => 'stream_out', short => 'O', type => 'file', mandatory => 'no', default => undef, allowed => undef, disallowed => undef },
{ long => 'verbose', short => 'v', type => 'flag', mandatory => 'no', default => undef, allowed => undef, disallowed => undef },The different keys are:
If you need more advanced argument checking than the parse_options subroutine provides, you will have to do it yourself after parse_options is called. For an example: Maasha::Common::error( qq(both --database and --genome specified) ) if $options->{ "genome" } and $options->{ "database" };
Maasha::Common::error( qq(no --database or --genome specified) ) if not $options->{ "genome" } and not $options->{ "database" };If your Biopiece does not need any non-mandatory options you just call parse_options with no arguments like this: $options = Maasha::Biopieces::parse_options(); Opening filehandles to the data streamLines 46-47. Here we open filehandles to incomming data from file or STDIN and outgoing data to file or STDOUT. Main iterativive loopLines 49-52. Here we have the main iterative loop of the Biopiece. You can manipulate the $record hash references from the data stream. Closing filehandles to the data streamLines 54-55. Here we close the filehandles to the data stream. BEGIN and END actionsLines 61-70. The BEGIN section sets the status file before anything else happens. The END section reads the status file and at the end of the Biopiece execution write the Biopiece log entry to the log file. subroutinesIf you want to modulate your code, which is always a good idea, you can place subroutines in a section beginning at line 57. Or better still. Write a Module and place in ~/biopieces/code_perl/<your_username>/ and include this module in the include section lines 29-30. temporary dataIf you need temporary files you can get a temporary directory using the subroutine Maasha::Biopices::get_tmpdir() that creates a directory in the $BP_TMP directory based on username and session id. The path to this temporary directory is returned, and the directory is automagically destroyed when the Biopieces execution is done - also, if the Biopiece is interupted the now stale temporary directory will be cleaned out when any other Biopiece is executed. $tmp_dir = Maasha::Biopieces::get_tmpdir(); verbose messagesUse the verbose option to allow for messages to show progress or debug: $count = 1;
while ( $record = Maasha::Biopieces::get_record( $in ) )
{
Maasha::Biopieces::put_record( $record, $out );
print STDERR "Records processed: $count\n" if $options->{ 'verbose' } and $count % 1000 == 0;
$count++;
} adding some testsFinally, add some tests to the Biopieces testing suite to check that everything is working. See Howto write tests for the Biopieces test suite. Howto create a Biopiece using RubyFirst copy and modify an existing wiki page, see Howto write usage information. Copying existing codeUse the code from a related Biopiece as template if possible, or use one of the simple ones such as swapcase_seq as template. cp $BP_BIN/swapcase_seq $BP_BIN/<new Biopiece> The codeThe swapcase_seq Biopiece is very simple and the code is showed below: 1 #!/usr/bin/env ruby 2 3 # Copyright (C) 2007-2011 Martin A. Hansen. 4 5 # This program is free software; you can redistribute it and/or 6 # modify it under the terms of the GNU General Public License 7 # as published by the Free Software Foundation; either version 2 8 # of the License, or (at your option) any later version. 9 10 # This program is distributed in the hope that it will be useful, 11 # but WITHOUT ANY WARRANTY; without even the implied warranty of 12 # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the 13 # GNU General Public License for more details. 14 15 # You should have received a copy of the GNU General Public License 16 # along with this program; if not, write to the Free Software 17 # Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301, USA. 18 19 # http://www.gnu.org/copyleft/gpl.html 20 21 # >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<< 22 23 # This program is part of the Biopieces framework (www.biopieces.org). 24 25 # >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>> DESCRIPTION <<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<< 26 27 # Swap lower case sequence to uppercase and visa versa for all sequences in the stream. 28 29 # >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<< 30 31 32 require 'maasha/biopieces' 33 34 options = Biopieces.options_parse(ARGV, cast = []) 35 36 Biopieces.open(options[:stream_in], options[:stream_out]) do |input, output| 37 input.each_record do |record| 38 record[:SEQ].swapcase! if record.has_key? :SEQ 39 output.puts record 40 end 41 end 42 43 44 # >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<< 45 46 47 __END__ The different sections of the Biopiece explainedLet us go over the different sections in this minimalistic Biopiece: Hashbang lineLine 1. First we have the hashbang line #!/usr/bin/env ruby, note that we use env ruby and not a fixed path! GPL LicenseLines 3-19. Next we have the license text. DescriptionLines 21-29. This section contains a short description that typically is a copy of the Summary section from the wiki file. Require statementsLine 32. Here we have a section with require statements. We always have the require 'biopieces' line and you are free to require other classes or modules. Casts check and option parsingLine 34. In this section we can define option casts, which instructs the Biopiece how to handle command line options. These casts are added to the 4 mandatory options that are included in all Biopieces: {:long => 'help', :short => '?', :type => 'flag', :mandatory => false, :default => nil, :allowed => nil, :disallowed => nil}
{:long => 'stream_in', :short => 'I', :type => 'files!', :mandatory => false, :default => nil, :allowed => nil, :disallowed => nil}
{:long => 'stream_out', :short => 'O', :type => 'file', :mandatory => false, :default => nil, :allowed => nil, :disallowed => nil}
{:long => 'verbose', :short => 'v', :type => 'flag', :mandatory => false, :default => nil, :allowed => nil, :disallowed => nil}The different keys are:
Also, the command line options are passed according to the specified casts. If you need more advanced option checking than provided by biopieces.rb, you will have to do it yourself after bp.parse, e.g.: raise "both --database and --genome specified" if options.has_key? "genome" and options.has_key? "database" raise "no --database or --genome specified" if not options.has_key? "genome" and not options.has_key? "database" Main iterativive loopLines 36-41. Here we have the main iterative loop of the Biopiece demonstrating how to manipulate records read from input and written to output. temporary dataIf you need temporary files you can get a temporary directory by calling Biopieces.mktmpdir which will create a directory in the $BP_TMP directory based on username and session id. The path to this temporary directory is returned, and the directory is automagically destroyed when the Biopieces execution is done - also, if the Biopiece is interupted the now stale temporary directory will be cleaned out when any other Biopiece is executed. verbose messagesUse the verbose option to allow for messages to show progress or debug: $stderr.puts "Verbose message" if options.has_key? "verbose" adding some testsFinally, add some tests to the Biopieces testing suite to check that everything is working. See Howto write tests for the Biopieces test suite. Howto create a Biopiece using PythonTo be written ... Howto create a Biopiece using CTo be written ... Howto write tests for the Biopieces test suiteThe advantage of having a testing suite is that it will alert you to any bugs accidently introduced in the code during further development of the Biopieces. Basically testing is done by having an input and a verified result file used for testing a single Biopiece at a time. The input file, which is typically a stream which is read with the -I switch is read with the Biopieces subject to testing and the output is written to a temporary file with the -O option. The testing suite checks if the temporary file and the result file are identical. If they are identical, the test is OK otherwise it is a FAIL. Biopieces for parsing different types of data will not be reading data from a stream file, but rather from a sample file with the appropriate data using the -i switch e.g. a FASTA file in the case of read_fasta. Similary, Biopieces for writing different types of data will be outputting that data using the -o switch. Sample files are loced in $BP_DIR/bp_test/in and result files in $BP_DIR/bp_test/out while the actual test files are located in $BP_DIR/bp_test/test. A minimal structure of the $BP_DIR/bp_test directory is showed below: $BP_DIR/bp_test/ |-- in | |-- align_seq.in | |-- grab.in | |-- grab.in.pat | |-- read_fasta.in | `-- write_fasta.in |-- lib | `-- test.sh |-- out | |-- align_seq.out.1 | |-- grab.out.1 | |-- grab.out.2 | |-- read_fasta.out.1 | |-- read_fasta.out.2 | |-- write_fasta.out.1 | `-- write_fasta.out.2 |-- test | |-- test_align_seq | |-- test_grab | |-- test_read_fasta | `-- test_write_fasta `-- test_all The tests are written as shell scripts, but are really simple. Lets look at the test for align_seq located here $BP_DIR/bp_test/test/test_align_seq: #!/bin/bash source "$BP_DIR/bp_test/lib/test.sh" run "$bp -I $in -O $tmp" assert_no_diff $tmp $out.1 rm $tmp This test file contains a shebang line (the one starting with #!) and a source line that make sure the variables $bp, $in, $out, and $tmp are set. Finnally the test file contains, in this case, only one test. The test consists of a run command, a assert_no_diff command, and the rm command. The run command allows us to write a Biopiece command in short hand. In the above example we will in fact run the command: align_seq -I /Users/maasha/biopieces/bp_test/in/align_seq.in -O /Users/maasha/BP_TMP/align_seq.out.1 The $bp variable contains the name of the Biopiece based on the name convention used (the Biopiece tested is prefixed with test_ like in test_align_seq). The $in variable contains the path to the input file and the $tmp variable contains the path to a temporary file for outputting the test result. If we are running multiple tests that give different output we postfix the files with a forthrunning number. The assert_no_diff command checks if the resulting $tmp file differs from the validated $out file, and the result is OK if the files are identical, otherwise the result is FAIL. Finally, the rm command is used to remove the $tmp file. Here is an example of the output of the testing suite: maasha@mel:~$ $BP_DIR/bp_test/test_all Testing align_seq -I /Users/maasha/biopieces/bp_test/in/align_seq.in -O /Users/maasha/BP_TMP/align_seq.out.1 ... OK Testing grab -I /Users/maasha/biopieces/bp_test/in/grab.in -p SEQ -O /Users/maasha/BP_TMP/grab.out.1 ... OK Testing grab -I /Users/maasha/biopieces/bp_test/in/grab.in -p SEQ,COUNT -O /Users/maasha/BP_TMP/grab.out.2 ... OK Testing read_fasta -i /Users/maasha/biopieces/bp_test/in/read_fasta.in -O /Users/maasha/BP_TMP/read_fasta.out.1 ... OK Testing read_fasta -i /Users/maasha/biopieces/bp_test/in/read_fasta.in -n 1 -O /Users/maasha/BP_TMP/read_fasta.out.2 ... OK Testing write_fasta -I /Users/maasha/biopieces/bp_test/in/write_fasta.in -o /Users/maasha/BP_TMP/write_fasta.out.1 -x ... OK Testing write_fasta -I /Users/maasha/biopieces/bp_test/in/write_fasta.in -w 4 -o /Users/maasha/BP_TMP/write_fasta.out.2 -x ... OK Biopieces tested: 4 Tests run: 7 OK: 7 FAIL: 0 Time: 1 secs Howto get a Biopiece included at www.biopieces.orgSubmit your Biopiece and wiki page to mail@maasha.dk and it will be included after a review. |